Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Circular RNA AKT3 | |||
Gene | AKT3 | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | PMID | 30927924 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | GC tissues and adjacent nion cancerous tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TCCAAATAAACGCCTTGGTGG ReverseCCTCAGAGAACACCCGCTCT | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Huang, X, Li, Z, Zhang, Q, Wang, W, Li, B, Wang, L, Xu, Z, Zeng, A, Zhang, X, Zhang, X, He, Z, Li, Q, Sun, G, Wang, S, Li, Q, Wang, L, Zhang, L, Xu, H, Xu, Z (2019). Circular RNA AKT3 upregulates PIK3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression. Mol. Cancer, 18, 1:71. |